Skip to main content

Table 1 Primers used in this study

From: Agrobacterium tumefaciens-mediated transformation of Aspergillus aculeatus for insertional mutagenesis

Name Sequence (5' to 3')  
HS-1com1 TGCTCCATACAAGCCAACC  
HAS-2com ATCATCTGCTGCTTGGTGC  
AD-1 NGTCGASWGANAWGAA  
AD-2 GTNCGASWCANAWGTT  
AD-3 WGTGNAGWANCANAGA  
HS-1 GGCCGTGGTTGGCTTGTATGGAGCAGCAGA 436 bp from nick site in RBa
HS-2 TGGTCTTGACCAACTCTATCAGAGCTT 336 bp from nick site in RB
HS-3 GGACCGATGGCTGTGTAGAAGTA 193 bp from nick site in RB
HS-4 CTCGCCGATAGTGGAAACC 170 bp from nick site in RB, for sequencing
HAS-2 GCACCAAGCAGCAGATGAT 373 bp from nick site in LBb
HAS-3 AATAATGTCCTCGTTCCTGTCTGCTAATAA 354 bp from nick site in LB
HAS-4 CCGCCTGGACGACTAAAC 225 bp from nick site in LB
HAS-5 GACCTCCACTAGCTCCAGCC 187 bp from nick site in LB, for sequencing
pks-F_Nhe taggctagcGTAAGCTCACCGTCAAGGCA  
pks-R_Nhe ctggctagcAGATCCTAGAGACCCGGGAC  
  1. aRB, right border; bLB, left border